Current stock sequencing primers (Updated 14/02/2011)

 

ID
NAME
Sequence
Length
Tm
SEQ1
M13-Forward(-47) cgccagggttttcccagtcacgac
24
78
SEQ2
M13 Reverse gtgagcggataacaatttcacacagg
26
76
SEQ3
T7 (pGMT7) taatacgactcactataggg
20
56
SEQ4
T7 (Bluescript) gtaatacgactcactatagggc
22
64
SEQ5
T3 cgaaattaaccctcactaaaggga
24
68
SEQ6
SP6 tatttaggtgacactatag
19
50
SEQ7
pCDM8 Forward cccactgcttactggcttatcg
22
68
SEQ8
pCDM8 Reverse ggcgcagaactggtaggtatgg
22
70
SEQ9
OX281 agcaaaaaacccctcaagacccg
23
70
SEQ10
pRC/CMV Forward ccactgcttaactggcttatcgaa
24
70
SEQ11
pRC/CMV Reverse agtcgaggctgatcagcgagct
22
70
SEQ12
TH (-40) gctgacagactaacagactgttcc
24
72
SEQ13
pSC11 5' tcataaagaacagtgacggatccc
24
70
SEQ14
pSC11 3' gaaatgtcccatcgagtgcggc
22
70
SEQ15
pCDNA3 5' cccactgcttactggcttatcg
22
68
SEQ16
pCDNA3 3' cgagctctagcatttaggtgac
22
66
SEQ17
FCD5 aaccgctggccaccttgtacc
21
70
SEQ18
RFC tgggcacggtgggcatgtgtg
21
68
SEQ19
RT7 gctagttattgctcagcggtggc
23
72
SEQ20
FGFPN ggaggtctatataagcagagctgg
24
72
SEQ21
RGFPN tcgccgtccagctcgaccagg
21
72
SEQ22
FGFPC gtcctgctggagttcgtgaccg
22
72
SEQ23
RGFPC aacctctacaaatgtggtatggctg
25
72